Many pathogens produce virulence factors against their natural hosts. Clinically, methicillin-resistant Staphylococcus aureus (MRSA) isolates are highly adapted to humans and produce a series of human-specific virulence factors. One such factor is LukAB, a recently discovered pore-forming toxin that targets human phagocytes by binding to the integrin component CD11b. LukAB shows a strong tropism to human CD11b, but not to rodents. Here, phylogenetic and biochemical studies have led to the identification of the 11 residue domains necessary for the specificity of LukAB to human CD11b, which is sufficient to make murine CD11b compatible with toxin binding. CRISPR-mediated gene editing was used to replace this domain, resulting in “humanized” mice. In vivo studies have shown that humanized mice are more sensitive to MRSA bloodstream infection (a phenotype mediated by LukAB). Therefore, these studies establish LukAB as an important toxin of MRSA bacteremia and describe a new mouse model for studying the pathobiology of MRSA.
For humans, several of the most deadly and common pathogens are species-specific and can only infect humans or closely related non-human primates (1). Other human pathogens have the ability to infect a wider range of species, but these infections do not faithfully summarize human diseases. Host tropism can be determined by host limiting factors, incompatible receptors necessary for pathogen invasion or adhesion, differences in interaction with the host’s immune system, or differences in nutrient utilization (1). The co-evolution of microorganisms and hosts selects specific host-pathogen interactions for the survival and reproduction of microorganisms. At the same time, host immune factors and pathogen-targeted molecules will evolve to avoid being recognized by pathogens, and at the same time they can choose to perform immune functions. These interactions can be unfolded as a “molecular arms race,” in which pathogens and hosts must constantly adapt to survive. Therefore, pathogens may become highly specialized in their thriving species.
Staphylococcus aureus accounts for approximately 30% of the population and is located in the nostrils, skin and gastrointestinal tract (2). However, when Staphylococcus aureus enters deeper tissues, it can cause a variety of and serious infections, including skin and soft tissue infections, endocarditis, pneumonia, osteomyelitis, bacteremia, and sepsis. It causes about 500,000 hospitalizations (3, 4). Staphylococcus aureus also causes diseases in livestock (5) and rodents (6). These animal-related strains originated from humans, but have acquired new characteristics specific to their animal hosts, and in some cases, have lost the functions of genes related to human pathogenesis (7).
If administered at high doses, clinically relevant isolates of human Staphylococcus aureus can cause disease in mice through several routes of infection . Many studies on Staphylococcus aureus infection have been conducted using mouse models. However, these models cannot perfectly mimic human diseases (8). Although it has shown efficacy in preclinical murine models so far, all clinical trials of Staphylococcus aureus vaccines have failed so far. This fact may best explain this mismatch. The shortcomings of these models replicating diseases caused by human-adapted strains can be explained in part by the species specificity of a large number of Staphylococcus aureus virulence factors (8, 9). One such factor is the two-component porogen LukAB (9, 10) [also known as LukGH (11)]. After LukAB binds to the receptor CD11b (a component of ¦ÁM¦Â2 integrin (also known as MAC-1 and CR3)), it targets and kills human phagocytosis by forming holes (10, 11) in the target cell membrane Cell (12). Specifically, LukAB binds to the I domain of CD11b with high affinity (12). LukAB is produced during human infection (13), has been found in more than 99% of sequenced Staphylococcus aureus isolates (14), and is responsible for in vitro infection of methicillin-sensitive and methicillin-resistant S-period killing Dead primary human phagocytes. Staphylococcus aureus isolates (MSSA and MRSA respectively) (10, 11). Therefore, LukAB is considered to be a key virulence factor to relieve the host’s immune response and potential drug targets. However, LukAB has low activity on murine cells (12, 15), which hinders in vivo studies on the pathogenesis of the toxin on Staphylococcus aureus. The resistance to LukAB can be explained by the low-affinity binding of LukAB to the murine CD11b I domain, despite the 78% amino acid identity with the human I domain (12).
Here, we set out to analyze the breadth of LukAB’s species tropism and use this information to generate a susceptible mouse model. We examined the binding of LukAB to the CD11b I domain from various mammals, and combined this information with the evolutionary analysis of the CD11b I domain in primates and rodents. Our complementary approach revealed that residues exhibit the characteristics of repeated positive selection, including residues involved in LukAB binding. Using a series of I domain chimeras, we identified the 11 amino acid regions of human I domain that are essential for LukAB binding. Armed with this knowledge, we edited the murine genome to encode the humanized LukAB binding region in the murine CD11b I domain. After humanized mice were infected with MRSA in a LukAB-dependent manner, they showed higher infection susceptibility and bacterial burden. Therefore, by combining phylogeny, biochemistry and genetic engineering, we established the role of human-specific virulence factors in the pathophysiology of Staphylococcus aureus infection in a new mouse model system.
Previous studies have shown that LukAB can effectively target neutrophils in humans and cynomolgus monkeys. However, LukAB targets rabbit neutrophils with lower affinity, as evidenced by its EC50 (median effective concentration) which is about 100 times higher than human cells, while for mice with lower affinity, its EC50 is 2000 times higher than human cells (15)). These results are consistent with studies showing that LukAB has high-affinity binding to recombinant human I domains, while its binding to recombinant mouse I domains is weak or undetectable (12). We extend these studies by expressing and purifying recombinant I domains from different mammals (Figure 1, A and B) and examining the binding of LukAB to recombinant I domains (Figure 1C). As expected, we found that LukAB effectively binds to the human I domain in a saturable and specific manner. On the contrary, LukAB binds weakly to the mouse I domain and weakly binds to the rabbit I domain at a moderate level. In addition, we found that LukAB binds strongly to the I domains of horses, rhesus monkeys and pigs, and reflects the binding to human I domains (Figure 1C). The binding method of LukAB to the rat I domain is similar to that of the intermediate binding to the rabbit I domain, while the binding to the I domain of Chinese hamsters, sheep and cattle is almost undetectable (Figure 1C). The I domain that binds firmly to LukAB has >80% homology with the human I domain, while the I domain with <80% identity to the human I domain shows only weak or intermediate binding (Figure 1D).
(A) A phylogenetic tree based on the amino acid sequence of the CD11b I domain of different species and the percentage of amino acid identity with the human I domain. (B) Coomassie staining of 1 ¦Ìg of LukAB and I domains. (C) As measured, the binding of LukAB to the recombination I domain of the species examined in (A). The data was normalized to the maximum absorbance at 450 nm of LukAB bound to the human I domain. The data is expressed as the mean ¡À SEM of three independent experiments. Compared with the mouse I domain, statistical significance was determined by two-way analysis of variance (****P<0.0001; **P<0.01; *P<0.05; ns, not significant). (D) Linear regression analysis of the percentage of binding of 1 ¦Ìg/ml (relative to the human I domain) and the percentage of amino acid identity with the human I domain.
CD11b is a receptor for more than 40 different ligands and plays a key role in the immune system. CD11b knockout mice have increased susceptibility to microbial sepsis (16) and multiple infections (17, 18). CD11b can also be used as a target for LukAB and a series of other microorganisms and microbial factors (12, 19-22). Therefore, CD11b may be under selective pressure so as not to be recognized by virulence factors, while retaining its key role in immune function.
To examine the evolution of CD11b, we performed a phylogenetic analysis on the sequences collected from samples of 19 anthropomorphic primate species (Table S1) and 13 rodent species (Table S2). We use the complementary maximum likelihood of phylogenetic analysis [physical analysis through maximum likelihood (PAML)] and Bayesian [HyPhy: Evolutionary Mixed Effects Model (MEME) and Fast Unbiased Bayes Approximation (FUBAR)] It is implemented to calculate the ratio of non-synonymous and synonymous substitution rates (dN / dS) for each position in the CD11b coding sequence. In primate and rodent clades, significant increases in dN/dS values were observed for multiple residues in CD11b (Figure 2A) (Table S3). These results indicate that ITGAM (CD11b coding gene) has undergone repeated positive selection, reminiscent of many typical innate immune factors (23, 24). The sites undergoing positive selection are mainly concentrated in the CD11b I domain (Figure 2A), which binds to endogenous ligands and LukAB (25).
(A) Sites undergoing episodic (MEME and PAML) and permeability (FUBAR) positive selection in full-length CD11b are indicated by triangles. (B) The structure of human I domain [Protein Database (PDB) ID: 1IDO]. Residues showed the characteristics of positive selection in three independent algorithms [FUBAR (P> 0.9); PAML (M7 vs. M8, P¡Ü0.05); MEME (P¡Ü0.05)] were displayed as spheres and marked. (C to E) The binding of LukAB to I domain mutants (C) and I domains from various primates (D) and rodents (E) was measured. The data was normalized to the maximum absorbance at 450 nm of LukAB bound to the human I domain. The data is expressed as the mean ¡À SEM of three independent experiments. Statistical significance was determined by two-way analysis of variance (**** P <0.0001; *** P <0.001; ** P <0.01). (F) Primate and rodent tables analyzed in (D) and (E), showing the percent amino acid identity to human I domain and residues at positions 164, 222, and 294.
We hypothesized that the positive selection signature of sites within the CD11b I domain may be driven by interaction with virulence factors produced by pathogens including LukAB. In the apes and rodent clades, amino acid positions 164, 222, and 294 showed the shared characteristics of universal positive selection in three independent analyses (PAML, MEME, and FUBAR) (Figure 2B). To determine whether the amino acid changes at these positions affect the interaction between CD11b and LukAB, we mutated these residues between the human and mouse I domains (Figure S1A). Compared with the human I domain, the mutation of glutamic acid (E294) at position 294 in humans to proline (mouse residue) or lysine (basic residue) resulted in a significant decrease in LukAB binding. However, mutating the proline at position 294 in the mouse I domain to glutamic acid (P294E) did not result in increased LukAB binding, indicating that LukAB binding requires other residues in the human I domain. Mutation of the histidine at position 164 and the leucine at position 222 to the murine residue (H164IL222N) did not affect the binding of LukAB to the human I domain. The binding of LukAB to the human I domain (all three residues are mutated to murine residues) is similar to E294P and E294K, further supporting that residues 164 and 222 may not participate in toxin-receptor interactions, but may reflect Interactions with other CD11b-pathogens.
Next, we checked the binding of the I domain of other primates, which were included in our analysis and differed from the human amino acid codes at positions 164, 222, and 294. Despite the high homology with human I domain (89%), the I domain from Angola colobus showed reduced binding to LukAB (Figure 2, D to F). This reduced binding can be explained by the fact that the I domain contains leucine at position 294 (Figure 2, D to F). In contrast, the golden nose monkey also has leucine at this position, but the binding of LukAB to the human I domain and the binding of the I domain. Therefore, these findings suggest the combined contribution of the combination of sites where LukAB binds.
We also examined the binding of LukAB to the I domain of other rodents. We found that the Kangaroo rat I domain of Ord showed great binding compared to the murine I domain (Figure 2E). The kangaroo rat I domain of Ord contains glutamic acid at position 294, which is conserved with the human I domain. The loop around the site also highly protects humans. We hypothesized that this loop is very important for the binding of LukAB to the I domain of Ord kangaroo rat, even though the total amino acid identity between this I domain and the human I domain is only 78% (Figure 2F).
Together, these data indicate that ITGAM has undergone a series of positive selections at selected residues (especially in the I domain). We identified site 294 as one such site, which is important for LukAB binding.
In order to further divide the LukAB binding interface in the CD11b I domain, we compared the amino acid sequences of the human and mouse I domains (Figure 3A), and mapped different amino acids on the human I domain structure (26). We found that most of the different amino acids are surface exposed (Figure 3B). According to the position in the I domain, we divide the different amino acids into 7 groups (Figure 3, A and B). Recombinant chimeric I domains (HMH chimeras) containing murine residues from each of the seven groups in the human I domain backbone were generated and used for binding studies (Figure S2, A and B). LukAB binds to HMH chimeras 1 to 6 at a level similar to wild-type (WT) human I domains (Figure 3C). In contrast, the binding of LukAB to HMH chimera 7 is weak.
(A) Amino acid alignment of mouse and human I domains. The different amino acids are highlighted. Each color represents a different I domain chimera. (B) The structure of human I domain (PDB ID: 1IDO). The conserved region of the mouse I domain is shown in gray, and the color of the divergent region is shown in (A). (C to E) LukAB binds to human, mouse, HMH chimera (mouse residues in the human I domain backbone) (C to E) and MHM chimera (human residues in the mouse I domain backbone) (D And E) I-domain. HMH 7289-316 and MHM 7289-316 respectively represent HMH 7 and MHM 7 shown in (C and D) (E). The data was normalized to the maximum absorbance at 450 nm of LukAB bound to the human I domain. The data is expressed as the mean ¡À SEM of three independent experiments. Compared with human (C) or mouse (D) I domain, statistical significance was determined by two-way ANOVA (**** P <0.0001; *** P <0.001; ** P <0.01). (F) The structure of human I domain (PDB ID: 1IDO). The conserved regions of the mouse I domain are shown in gray, while the divergent regions are shown in the same color scheme as (A) and (B). Residues 292 to 295 from chimera 7 are shown as spherical. (G) LukAB binds to HEK293T cells transfected with full-length CD11b and CD18. The percentage of LukAB bound to CD11b+ cells was evaluated by flow cytometry. The data is expressed as the mean ¡À SEM of three independent experiments. Compared with mouse CD11b, statistical significance was determined by two-way analysis of variance (**** P <0.0001; *** P <0.001; * P <0.05). See also figure. S2.
We also performed a reverse experiment in which the same amino acids were mutated to human residues in the mouse I domain backbone (MHM chimera). Although the binding of LukAB to MHM chimeras 1 to 6 is weak, the binding level of the toxin to MHM 7 is similar to that of human I domain (Figure 2D). Therefore, region 7, which contains amino acids 289 to 316, is necessary for the binding of LukAB to the human I domain, and is sufficient to make the murine I domain compatible with LukAB binding. It is worth noting that glutamate 294 falls within this region, further supporting the importance of this residue in the LukAB/I domain interaction.
The amino acids in Chimera 7 span the loop and part of the helical structure and are close to the metal ion-dependent adhesion site (MIDAS) of the I domain. The divalent cation at this site is essential for the binding of most endogenous CD11b ligands (27), and this region may also be critical for LukAB binding. Therefore, we next tried to further reduce the LukAB binding region on the CD11b I domain. After testing other chimeras and examining the smaller residue set in Chimera 7, we found that the chimera with the Muridae I domain backbone humanized only residues 292 to 295 (MHM 7292 295) ( Figure 3E) Compatible in combination with LukAB. Similar to the way of human I domain and full length MHM 7 (MHM 7289-316). In addition, if we change every other mutated residue in MHM 7, except for residues 292 to 295 of the human sequence in the mouse I domain backbone (MHM 7289, 298-316), LukAB binds poorly and binds to the mouse I structure. The domains are similar.
To further expand the enzyme-linked immunosorbent assay (ELISA) data, we performed surface plasmon resonance (SPR) to measure the binding kinetics of LukAB with key chimeras (Table 1). We found that the dissociation constant (KD) of the human I domain is 39.29 nM, while the KD of the mouse I domain has a magnitude greater than 6000 times at 246.6 ¦ÌM. The KD of our combined chimera MHM 7 is 69.60 nM, which is 1.7 times higher than that of the human I domain. In contrast, the KD of MHM 7292-295 is 173.98 nm, which is 4.4 times larger than that of the human I domain, which indicates that the residues other than the 292-295 loop in the MHM 7 chimera also contribute to toxin binding.
The above studies identified that human residues 289 to 316 are sufficient to make the purified murine I domain compatible with LukAB binding. Next, we want to determine whether the introduction of human 289 to 316 residues into the full length, surface-exposed murine CD11b can make the receptor compatible with toxin binding. The plasmid was used to transfect human embryonic kidney (HEK) 293T cells to encode a full-length murine CD11b containing the entire human I domain or MHM 7 chimeric I domain and murine CD18 (Figure S2C). Although the expression of human CD11b/CD18 made the cell compatible with LukAB binding, the expression of murine CD11b/CD18 did not, thus validating the whole cell binding assay. We found that LukAB can bind to cells that produce humanized murine CD11b, which contains WT human I domain sequence or 11 human residues in MHM 7 (Figure 3G). Therefore, the LukAB binding domain in humanized murine CD11b makes the host cell compatible with LukAB binding.
The significant increase in LukAB binding observed in the MHM 7 chimera prompted us to evaluate whether this region can be humanized in mice. Murine Itgam is a large gene containing 55,852 nucleotides and 30 exons. Fortunately, the region identified here as critical for LukAB binding is only encoded by exon 9. We used CRISPR-Cas9 (28) to edit exon 9 encoding human residues 289 to 316 (Figure 4A and Figure S3A). Produced “humanized CD11b” mice (hCD11b mice), and found their appearance, reproductive ability, viability and health status were normal.
(A) Schematic diagram of the murine Itgam locus and DNA template used to humanize exon 9. (B to D) CD11b, F4/80 and MHC II of iBMDMs from WT and hCD11b mice were stained and evaluated by flow cytometry (B). (C) WT and hCD11b iBMDM were incubated with GFP-producing Staphylococcus aureus ¡À serum, and phagocytosis was measured by flow cytometry as% of GFP-positive iBMDMs. Data are expressed as the average of three independent experiments performed in replicate ¡ÀSEM. (D and E) WT and hCD11b iBMDM (D) and peritoneal exudative cells (E) were incubated with biotinylated LukAB, and the bound LukAB was quantified by flow cytometry. Data are expressed as the average of three independent experiments performed in replicate ¡ÀSEM. Statistical significance was determined by two-way analysis of variance (**** P <0.0001; *** P <0.001; ** P <0.01; * P <0.05). (F) The peritoneal exudative cells from WT and hCD11b mice were treated with LukAB, and the incorporation of propidium iodide (PI) was quantified by flow cytometry. Data are expressed as the average of three independent experiments performed in replicate ¡ÀSEM. Statistical significance was determined by two-way analysis of variance (**P<0.01 and *P<0.05). (G) Staining of peritoneal exudative cells treated with LukAB (12.5¦Ìg/ml), PI positive PMNs (CD11b + and Ly6G +), macrophages (CD11b + and F4 / 80 +), monocytes (CD11b +, Ly6C + and Ly6G-) were stained, and DCs (CD11b +, CD11c + and F4/80-) were quantified by flow cytometry. Data are expressed as the average of three independent experiments performed in replicate ¡ÀSEM. Statistical significance was determined by one-way analysis of variance (*** P <0.001).
To characterize these mice, we first harvested bone marrow cells from hCD11b and WT mice and produced immortalized bone marrow-derived macrophages (iBMDM) (29). It was found that iBMDM from WT and hCD11b mice had the same level of CD11b, F4/80, and major histocompatibility complex (MHC) class II on their surfaces (Figure 4B). In addition, hCD11b cells can phagocytose green fluorescent protein (GFP) Staphylococcus aureus in both phagocytosis and non-phagocytosis of serum, similar to wild-type WT (Figure 4C). Therefore, it seems that hCD11b mice do not completely change CD11b-dependent functions or expression levels.
Next, the binding of LukAB to iBMDM from WT and hCD11b mice was measured. Consistent with the HEK293T whole-cell binding study (Figure 3G), we observed that LukAB binds to hCD11b-producing mouse cells, but weakly binds to WT mouse cells (Figure 4D). To confirm these data, we measured the interaction between LukAB and murine iBMDM using whole-cell SPR. The affinity for iBMDM expressing hCD11b is 13 times higher than that for iBMDM expressing WT CD11b, with a KD of 187.7 nM (Figure S3B).
Next, we performed other functional studies using freshly isolated primary mouse peritoneal exudate cells. Compared with WT mice, we observed improved binding in cells from hCD11b mice (Figure 4E). It is worth noting that increased LukAB binding is directly related to toxin-mediated hCD11b peritoneal exudative cell membrane damage (Figure 4F). Peritoneal exudative cells contain a variety of white blood cells expressing CD11b, including polymorphonuclear neutrophils (PMN), macrophages, monocytes and dendritic cells (DC). In order to determine the target of LukAB, we treated primary murine peritoneal secretions from hCD11b mice with toxins and performed multi-parameter flow cytometry analysis. These studies indicate that PMN is the leukocyte that is mainly susceptible to LukAB-mediated membrane damage, followed by monocytes and DC (Figure 4G).
Next, we determined whether hCD11b mice are more susceptible to intravenous Staphylococcus aureus infection. We used the MRSA strain LAC (Los Angeles County), which is representative of the USA300 type of pulse field gel electrophoresis. It is the most common cause of community-acquired MRSA infections and an emerging cause of MRSA infections associated with hospitals in the United States. State (30). Age-matched WT and hCD11b mice were infected with 3¡Á106 colony forming units (CFU) of USA300 retro-orbitally, and the bacterial load in the organs was examined 3 days after infection. In this experimental environment, only about 30% of WT mice showed a detectable bacterial burden in the liver. In contrast, hCD11b mice have a detectable bacterial load in 86% of mice, which is dependent on the LukAB phenotype (Figure 5A). Therefore, the humanization of CD11b reduces the infection barrier exhibited by WT mice. By examining the bacterial load in the organs, we found that compared with WT mice, the increase in CFU in the liver of hCD11b mice was more than 1-log (Figure 5B). It is worth noting that there were no statistically significant differences in the bacterial burden of the spleen, kidneys, heart, and lungs, and there were no differences in weight loss or survival rates (Figure S4, A and B). The increased CFU phenotype observed in hCD11b mice also depends on LukAB, because WT mice infected with the ¦¤lukABUSA300 phenotype were infected with WT USA300 and hCD11b mice (Figure 5B).
(A and B) Infect WT and hCD11b mice intravenously with WT USA300 strain LAC or syngeneic DelukABLAC strain ~3¡Á106 CFU. Three days after infection, the percentage of mice with detectable CFU in the liver was determined (A). Statistical significance was determined by chi-square test (** P <0.01). (B) CFU in the liver is also quantified. The data is expressed as the average of three independent experiments with 15 mice per group. Statistical significance was determined by one-way analysis of variance (**P<0.01 and *P<0.05). (C) Infect WT and hCD11b mice intravenously with 1¡Á107¦¤lukAB::p LAC or ¦¤lukAB::plukAB LAC. One day after infection, the CFU in the liver was quantified. The data is expressed as the average of two independent experiments with 10 mice per group. Statistical significance was determined by one-way analysis of variance (*P<0.05). (D and E) hCD11b mice were intravenously infected with 1¡Á108 CFU of WT LAC or the syngeneic DelukABLAC strain. (D) CFU in liver and kidney 1 day after infection. (E) The tissue homogenate from (D) is also used to quantify LukAB. The data is expressed as the average of three independent experiments with 15 mice per group. Statistical significance was determined by one-way analysis of variance (** P <0.01). See also figure. S4. (F) WT mice were infected with Staphylococcus aureus intravenously. One day after infection, Ly6G + CD11b + PMNs in all CD45% leukocytes were quantified. The data is expressed as the average of two independent experiments with a total of six mice per group. Statistical significance was determined by one-way analysis of variance (*** P <0.001).
Next, we performed complementation studies by infecting mice with 1¡Á107 CFU of ¦¤lukABUSA300 or an isogenic strain expressing lukAB on a plasmid. Organs were harvested 1 day after infection to minimize the loss of complementary plasmids. These studies further proved that the liver CFU of hCD11b mice increased in a LukAB-dependent manner (Figure 5C). Therefore, humanized CD11b reduces the resistance of mice to MRSA blood infection in a way that depends on LukAB.
We hypothesized that the observed increase in liver-specific bacterial load may be due to the differential regulation/production of LukAB in the body. To solve this problem, we developed an ELISA to quantify the amount of LukAB produced in the body. One day after infection, we checked the levels of LukAB in the liver and kidneys. Although the bacterial burden was comparable at this time point (Figure 5D), we were able to detect LukAB in the liver of infected mice but not in the kidneys (Figure 5E and Figure S4, C and D). Therefore, compared with other organs, LukAB appears to be produced at a higher level in the liver, and is one of the first organs infected after blood infection (31), which contributes to the increase in the bacterial burden mediated by liver-specific LukAB Possible explanations.
The tissue-specific phenotype can also be explained by the recruitment and/or local number of susceptible cells. Since PMN is the main hCD11b cell type susceptible to LukAB infection (Figure 4G), we quantified PMN in the liver and kidney of uninfected control mice 1 day after infection. These studies show that compared with uninfected liver, the proportion of PMNs in the infected liver 1 day after infection increased by more than 10 times, while the PMNs in the kidneys were still very low at this time (Figure 5F and Figure S4). Taken together, these data indicate that the number of cells targeted by LukAB and LukAB increased in the early liver after infection, providing an explanation for the increase in tissue-specific LukAB-mediated bacterial burden.
Here, we defined the species-specific molecular determinants exhibited by LukAB toxins and used this information to establish an improved mouse model of Staphylococcus aureus infection. In order to understand how LukAB binds to the human CD11b I domain but not to the mouse I domain, we first adopted an extensive evolutionary genetic approach, focusing on the substantial variation observed between primates and rodents. . We found that multiple sites in CD11b, especially in the I domain, showed the characteristics of universal positive selection. This shows that these sites have been under strong and repeated selective pressure, which is conducive to substitution and reduces the ability to identify pathogens. Since these signals are inferred from the primate divergence of approximately 40 million years and have similar evolutionary intervals in our rodent sampling, it is necessary to determine the results of the selection of specific ancient pathogens over a long period of time Challenging. However, the repeated selection sites in the I-domain are consistent with repeated interactions with pathogens encoding LukAB-like functions. Due to the interaction of past evolutionary results, these repeated selections may make modern species more resistant or susceptible to contemporary infections. Among these positions in the I domain, we identified a residue, glutamic acid at position 294 (E294), which plays a role in LukAB binding. By examining the residues at this site in rodents, we determined that Ord¡¯s kangaroo rat I domain is compatible with LukAB, although its overall homology with human I domain is low. We hypothesize that this is due to the amino acid sequence of the glutamic acid at position 294 and the surrounding loop, which is highly overlapping with humans. However, E294 is not only responsible for LukAB binding. Using a series of I-domain chimeras, we found a region containing 11 divergent amino acids, which is necessary for binding. Replacing this region with a human sequence resulted in high-affinity LukAB binding to mouse CD11b.
Due to the weak binding of LukAB to murine CD11b, the contribution of this toxin to Staphylococcus aureus infection is underestimated in the current murine model. To address this defect, we generated mice containing the murine CD11b receptor, which were engineered to retain 11 human amino acids that are essential for LukAB to bind to the human CD11b I domain. hCD11b mice seem to have undisturbed CD11b function, which may be due to the fact that the region we mutated is small and the domain is not involved in binding to other CD11b ligands. Overall, our data indicate that these mice are more susceptible to MRSA infection. Infection of WT USA300 to WT mice The phenotypic infection of ¦¤lukAB USA300 to hCD11b mice highlights that the increased sensitivity described here is mediated by LukAB, and hCD11b mice themselves are not more susceptible to lack of LukAB strains. Effects of Staphylococcus aureus infection.
We found that despite the similar bacterial burden 1 day after intravenous infection, LukAB is produced in the liver at a high level compared to the kidney. In addition, in hCD11b mice, PMN, the main phagocytic cell susceptible to LukAB, was significantly increased in the liver after 1 day of infection, but remained low in the infected kidney. These findings are complementary to studies that show that despite the high bacterial burden, renal abscess formation with large PMN infiltration was first observed about 3 days after intravenous Staphylococcus aureus infection (32). In contrast, the liver has been shown to play a key role in intravenous Staphylococcus aureus infections. After infection, the bacteria are quickly isolated and controlled by Kupffer cells in the liver, forming a bacterial pool (31). Eventually, the bacteria will escape and spread to other organs, or the infection will be contained. Together, this can explain why we observe LukAB-dependent phenotypes in the liver under the conditions examined, but not in other organs such as the kidneys. In the presence of Staphylococcus aureus, CD11b on PMNs has been up-regulated (33), while in the presence of PMNs, LukAB has been up-regulated (34). Therefore, the host responds to the presence of bacteria by recruiting PMN with high levels of CD11b, but the bacteria utilize the bacteria by producing LukAB to harm these cells.
Here, we specifically describe a blood infection model. However, Staphylococcus aureus is responsible for a wide variety of diseases, and the role of LukAB needs to be characterized in other models (for example, skin infections, pneumonia, osteomyelitis, device-related infections, etc.). In the future, it will be interesting to determine whether this liver phenotype depends on the site of infection.
LukAB is one of many Staphylococcus aureus virulence factors that exhibit human tropism. We report here a roadmap showing how the combination of evolutionary research with biochemistry and genetic engineering can facilitate in vivo studies of species-specific host-pathogen interactions. By humanizing or knocking out human-specific targets, it should be feasible to generate improved mouse models that more closely mimic human infections. These models will also help to evaluate the effects of anti-S research. Staphylococcus aureus therapy is designed for previously untested virulence factors, improving our ability to identify suitable targets for the production of much-needed anti-S antibodies. Golden yellow agent.
All experiments involving animals have been reviewed and approved by the New York University Institutional Animal Care and Use Committee, and are conducted in accordance with the guidance of the National Institutes of Health (NIH), the Animal Welfare Act and the United States federal law.
E. coli DH5a was used in the cloning procedure. E. coli T7 LysY / LacQ is used for the expression of the CD11b I domain of human FLAG tags. All E. coli strains are grown in Luria-Bertani (LB) broth.
The Staphylococcus aureus strains used in this study are listed in Table S4. For recombinant protein expression and infection studies, Staphylococcus aureus strains were streaked into single colonies on Tryptic Soy Agar (TSA) plates. A single colony was inoculated in Tryptic Soy Broth (TSB) and cultured overnight, and then subcultured in TSB at 1:100 for 3 hours.
I domain from human ITGAM (NM_001145808.1) and murine Itgam (NM_001082960.1), as well as 5′Nde I site, 3’6-glycine linker, 3’3¡ÁFLAG tag, 3′Xho I site , The gBlocks gene fragment from Integrated DNA Technology (IDT) produced the required mutations (Table S6) and cloned into pET15b using standard cloning methods. As previously described (12), the plasmid was transformed into E. coli T7 LysY/LacQ and purified. In short, the strain was grown in LB broth supplemented with ampicillin (100¦Ìg/ml) at 37¡ãC and 180 rpm to an OD600 (optical density at 600 nm) of 0.5, and then used 1 mM isopropyl ¦Â-d-1-thiogalactopyranoside induction (IPTG) for 3 hours. The bacteria were lysed with xTracter buffer (Clontech) supplemented with protease inhibitor (Roche), lysozyme (1 mg/ml) and benzoic nuclease (Sigma) at a concentration of 3 U/ml. Incubate the lysate with nickel-trifluorotriacetic acid (NTA) resin (Qiagen), wash and add histidine tag. The I-domain is eluted with 500 mM imidazole. The purified protein was dialyzed in 1x tris buffered saline (TBS) + 10% glycerol at 4¡ãC overnight, and then stored at -80¡ãC.
As mentioned above (34), LukAB with 5’6x-histidine tag was co-purified from Staphylococcus aureus (Table S4). In short, the strain was grown in TSB containing chloramphenicol (10¦Ìg/ml) at 37¡ãC and 180 rpm for 5 hours until the OD600 was about 1.5 (representing 1¡Á109 CFU/ml). The bacteria are then precipitated, and the supernatant is collected and filtered. NTA resin (Qiagen) was incubated with the culture supernatant, washed, and eluted with 500 mM imidazole. The protein was dialyzed overnight at 4¡ãC in 1x TBS and 10% glycerol, and then stored at -80¡ãC.
The recombinant I domain (10 ¦Ìg/ml) was coated in the wells of an Immulon 2HB 96-well plate in phosphate buffered saline (PBS) at 4¡ãC overnight. The wells were blocked with a suction buffer (2% non-fat dry milk, 0.9% NaCl, 0.05% Tween 20, PBS), washed, and incubated with the specified concentration of LukAB in the suction buffer at room temperature under shaking conditions 30 minutes. Wash wells and incubate with anti-LukA rabbit polyclonal antibody at a dilution of 1:3000 for 1 hour at room temperature, shaking at room temperature. Next, the wells were washed and incubated with anti-rabbit horseradish peroxidase (HRP) at a dilution of 1:2500 at room temperature for 1 hour with shaking. Wash wells and incubate with 100 ¦Ìl 3,3′,5,5′-tetramethylbenzidine (TMB) substrate for 5 minutes. The reaction was terminated with 100 ¦Ìl sulfuric acid, and the absorbance at 450 nm was measured.
Use BLAST search to retrieve the full-length complementary DNA sequence of CD11b from the National Center for Biotechnology Information (NCBI) database. Use the default setting of MUSCLE to align all DNA sequences. Manually trim the sequence to eliminate all insertions, deletions and stop codons. Evolutionary analysis is performed using pruned comparison files and a constrained species tree, which represents the most commonly accepted evolutionary relationship between apes and rodents.
The positive selection characteristics of the evolutionary dominance of great apes and rodents were evaluated separately. The trimmed alignment file and phylogenetic tree are used as input files for three complementary software packages: PAML (v4.8, M7 and M8) and the MEME and FUBAR algorithms available through the HyPhy software package. The sites identified as having sporadic and universal diversified selection characteristics in all three algorithms are considered reliable candidates for further functional characterization.
The following antibodies were used: anti-LukA rabbit polyclonal antibody (10), goat anti-rabbit immunoglobulin G HRP (SC-2004), allophycocyanin (APC) anti-mouse/human CD11b, clone M1/70 (BioLegend, 101212); APC anti-mouse F4/80, clone BM8 (BioLegend, 123115); APC-Cy7 anti-mouse IA/IE, clone M5/114.15.2 (BioLegend, 107627); Phycoerythrin (PE)-Cy7 anti Mouse/human CD11b, clone M1/70 (BioLegend, 101215); Fluorescein isothiocyanate (FITC) anti-mouse Ly6G, clone 1A8 (BD Biosciences, 551460); APC anti-mouse F4/80, clone BM8 ( BioLegend, 123116); Momordica charantin Chlorophyll protein (PerCP) Cy5.5 anti-mouse Ly6C, HK1.4 (BioLegend, 128011); BV421 anti-mouse CD11c (BioLegend, 117329); V500 anti-mouse/human CD11b, clone M1 / 70 (BD, 562128); PE-Cy7 anti-mouse CD45, clone I3/2.3 (BioLegend, 147704); PE anti-mouse Ly6G, clone 1A8 (BD, 551461); Anti-LukA rabbit polyclonal serum (35); And anti-LukAB monoclonal antibody.
The anti-LukAB monoclonal antibody was customized by Envigo Inc. according to its approved standard operating procedures for the generation of mouse monoclonal hybridoma cells. In short, recombinant LukAB (rLukAB) is emulsified with Freud’s complete adjuvant for the primary immunization, and then with Freud’s incomplete adjuvant emulsified rLukAB for a booster immunization, and then with TiterMax adjuvant The emulsified rLukAB undergoes another immunization or two. The immunized mice were sacrificed, spleen cells were collected and fused with NS01 myeloma cells to produce hybridomas. Monoclonal hybridoma cell lines were selected by ELISA.
As mentioned earlier, use the Biacore T200 system (GE) to run SPR with the following modifications (12). In short, use the NHS capture kit to fix the recombinant I domains (mouse, human and mutant) on the flow cells 2 to 4 of the series S sensor chip CM5 (GE), and fix the flow cell 1 as a blank . Using single-cycle kinetics, LukAB was performed in two batches in five concentration ranges from 0.008 to 5 ¦Ìg/ml and 0.16 to 100 ¦Ìg/ml. The optimal range of interaction was carried out three times. The running buffer of all SPR experiments was 1¡ÁPBS with a pH of 6.8, and all data were subtracted by double reference.
Twelve-week-old mice were euthanized with CO2, sprayed with 70% ethanol, and then fixed on a polystyrene foam block. The collection of mouse bone marrow cells is as follows. Remove the skin and muscles of the hind legs, and use sharp sterile scissors to incise the femur above the buttocks. Remove the extra muscle, separate the femur and tibia, and place in cold RPMI/10% fetal bovine serum (FBS) in a six-well plate on ice. Remove the osteophytes from the bone and flush out the bone marrow with 10 ml RPMI/10% FBS. The bone marrow was then passed through a cell strainer and washed with the rest of the medium, and the cells were collected by centrifugation at 1500 rpm for 5 minutes. To remove red blood cells (RBC), add 2 ml of ACK (ammonium-chlorine-potassium) lysis buffer to the newly isolated bone marrow cells and incubate at room temperature for 2 minutes. The lysis buffer was then neutralized by adding 10 ml of RPMI medium, and the cells were centrifuged at 1500 rpm for 5 minutes. The cells were then resuspended in 10ml RPMI/10% FBS and counted.
The bone marrow cells (1¡Á106) were plated in an untreated 10 cm petri dish, and 30% L-929 supernatant (ATCC CCL-1) in Dulbecco’s modified Eagle medium (DMEM) was placed in the petri dish. Add 5 ml of additional medium on the 3rd day of differentiation. On the 7th day of macrophage differentiation, the supernatant of J2 fibroblasts (Kagan Laboratories) (29) was collected and filtered with a 0.45-¦Ìm filter. BMDM was grown in 50% J2 condition supernatant and 50% L-929 supernatant for 7 days, and a new batch of J2 and L-929 mixed supernatant was added on the third day. Then add 30% L-929 supernatant to complete DMEM until 90% confluence. Then 20% of the cells were transferred to a medium containing 25% L-929 supernatant. Following this trend, during each passage, the concentration of L-929 supernatant in intact DMEM will decrease by 5% until BMDM grows normally in DMEM without L-929 supernatant.
HEK293T cells and iBMDMs were maintained at 37¡ãC with 5% (v/v) CO2 in DMEM and supplemented with 10% (v/v) FBS and penicillin (100 U ml-1) and streptomycin (0.1 mg ml-1) Unless otherwise stated.
iBMDMs are grown in DMEM + 10% FBS + 1x penicillin/streptomycin. Spread the cells (2¡Á105) in a V-bottom 96-well plate, wash twice with PBS, and use 25¦Ìl of APC anti-mouse/human CD11b, APC anti-mouse F4/80 or APC-Cy7 anti in PBS to 1: 300 dilution of IA/IE and Fc blocker (BioLegend, 101320) were diluted 1:300. The cells were stained for 30 minutes on ice, washed twice with PBS, and fixed in 2% paraformaldehyde (PFA) in PBS, 2% heat-inactivated FBS, and 0.5% sodium azide. CytoFLEX flow cytometer (Beckman Coulter) was used to obtain flow cytometry data, and FlowJo software (TreeStar Inc.) was used to analyze the data.
The overnight culture AH-LACUSA300-¦¤lukABhlg::tet lukED::kan lukSF::spec-pOS1sGFP was subcultured at 1:100 in TSB + chloramphenicol (10 ¦Ìg/ml) and grown to mid-log phase. Wash the bacteria and resuspend them in the culture medium and dilute to a concentration of 5¡Á107 CFU/ml. The fused iBMDM was washed and resuspended in the culture medium at a concentration of 5¡Á105 cells/ml. Add 25 ¦Ìl of 5¡Á107 CFU/ml bacteria and 50 ¦Ìl medium or 2% mouse serum to the wells of the 96-well U-shaped bottom plate, and pre-incubate at 37¡ãC for 1 minute under shaking. Add 25 microliters of 5¡Á105 iBMDM per milliliter and incubate at 37¡ãC with shaking. Stop at the specified time by placing the sample on ice and adding 100¦Ìl of fluorescence activated cell sorting (FACS) fixation buffer [PBS + 2% FBS + 2% PFA + 0.05% (w/v) sodium azide] reaction. . CytoFLEX flow cytometer (Beckman Coulter) was used to obtain flow cytometry data, and FlowJo software (TreeStar Inc.) was used to analyze the data. Phagocytosis was determined to be %GFP positive cells.
The plasmids used in this study are listed in Table S5. Using the oligonucleotides in Table S6, the pCMV6-Entry mouse CD11b HI-domain and pCMV6-Entry mouse CD11b HMH 7-domain were cloned by FastCloning (36), and confirmed by sequencing.
HEK293T cells were transfected with calcium phosphate with the plasmids listed in Table S6. In short, 10 ¦Ìg/ml of each plasmid and 75 ¦Ìl of 2.5M CaCl 2 were added to deionized water to a final volume of 750 ¦Ìl. While aerating the mixture, add 750 microliters of 2x HEPES buffered saline (HBS) [50 mM HEPES (pH 7.05), 280 mM NaCl and 1.5 mM Na2PO4] dropwise. The solution was incubated at room temperature for 5 minutes, and then added dropwise to a 10 cm plate with 30 to 40% confluent HEK293T cells. Six hours after transfection, the medium was changed to pre-warmed DMEM + 10% FBS. The experiment was carried out 14 hours after transfection.
The protein was biotinylated using the EZ-Link NHS-PEG4-Biotin weightless format (Thermo Fisher Scientific) according to the manufacturer’s instructions. In short, the protein was purified as described above and dialyzed in 1x PBS overnight. The EZ-Link NHS-PEG4-Biotin reagent was added to the protein at a molar ratio of 1:20 and incubated at room temperature for 30 minutes. Remove unreacted biotin reagent by dialysis in 1x PBS overnight. Then the labeled protein was filter-sterilized, aliquoted and stored at -80¡ãC.
Add transfected HEK293T cells (1¡Á105), iBMDM or peritoneal exudative cells to each well of the V-plate, wash with PBS, and then incubate with 50¦Ìl of biotinylated LukAB in PBS at the indicated concentration on ice 10 minutes. . Before LukAB treatment, iBMDM and Fc blocker (1:100) were pre-incubated for 1 hour at 37¡ãC. Wash the cells twice with PBS, and use PerCP Cy5.5 streptavidin (1:300) (BioLegend, 405214), APC CD11b (1:300) (BioLegend, 101212) and Fixable Viability Dye eFluor 450 (1:1500) ) Staining (eBioscience, 65-0863-18) was placed in PBS on ice for 40 minutes. Wash the cells twice with PBS and resuspend in FACS fixation buffer [PBS + 2% FBS + 2% PFA + 0.05% (w/v) sodium azide]. CytoFLEX flow cytometer (Beckman Coulter) was used to obtain flow cytometry data, and FlowJo software (TreeStar Inc.) was used to analyze the data.
The whole mouse iBMDM expressing WT or hCD11b was fixed with 4% formaldehyde, washed 3 times with PBS, and resuspended at a concentration of 106 cells/ml. Using a method similar to that described by Mubaiwa et al., using the C1 wizard method on the Biacore T200 control system, fix the cells on the Series C1 C1 sensor chip. (37). The cells flowed at a speed of 5¦Ìl/min for 900 s to load the chip into a saturated state. Fix flow cell 1 in the blank position to perform two reference deductions. LukAB flows through the immobilized cells at a flow rate of 8 nM to 5 ¦ÌM.
24 hours and 48 hours before harvest, 8 to 9-week-old WT or hCD11b C57BL/6 mice were injected intraperitoneally with 1¡Á108 CFU heat-inactivated Staphylococcus aureus Newman strain. The mice were euthanized with CO2, and RPMI + 0.1% human serum albumin (HSA) + 10 mM HEPES were injected into the peritoneal cavity and massaged. Collect the cells and wash. Incubate the cells (150,000) with the specified concentration of LukAB in 5% (v/v) CO2 at 37¡ãC for 3 hours. The cells were washed with PBS and stained with PE-Cy7 CD11b (BioLegend, 101215), FITC Ly6G (BD, 557396), APC F4/80 (BioLegend, 123116), PerCP Cy5.5 Ly6C (BioLegend, 128011), BV 421 CD11c (BioLegend) , 117329) and blocked with Fc diluted 1:200 in PBS for 20 minutes on ice. The cells were washed twice and resuspended in PBS + 5% FBS + propidium iodide (PI) (2 ¦Ìg/ml) (G-Biosciences). Immediately use CytoFLEX flow cytometer (Beckman Coulter) to obtain flow cytometry data, and use FlowJo software (TreeStar Inc.) to analyze the data.
C57BL/6J fertilized eggs were collected from superovulated C57BL/6J mice. Microinjection with 45¦Ìl of filtered injection mixture consisting of guide RNA (50 ng/¦Ìl) [Alt-R CRISPR-Cas9 crRNA (IDT, guide sequence: CATGGGGCTGCTACCATCAG)] + Alt-R CRISPR-Cas9 tracrRNA (IDT, 1072533 ), GeneArt Platinum Cas9 nuclease (80 ng/¦Ìl; Invitrogen) and template DNA (10 ng/ml) (Table S6) in tris-EDTA buffer. The guide RNA and DNA templates are designed on Benchling.com. The Xho I restriction site was engineered into the DNA template to facilitate genotyping.
The injected fertilized eggs were implanted into pseudopregnant CD-1 (Charles River Laboratory) female animals, and the resulting 15 puppies were screened to screen out the allele encoding the expected modification in Itgam exon 9. Amplify the genomic DNA sample (Table S6), purify the polymerase chain reaction (PCR) product of 379 base pairs (bp), and cut it with Xho I. XhoI cut samples from 7 out of 15 animals, and Xho I cut PCR products. Sequence these animals. The two creators with the expected modifications were backcrossed to C57BL/6J mice for four generations. Then the G4 animals with the expected modifications are crossed to produce homozygous breeding pairs from two independent strains for colony enrichment and downstream research.
The mice are raised internally and kept under specific pathogen-free conditions, and are age-matched and sex-matched at 8 to 9 weeks of age. Using hCD11b and WT C57BL/6J mice for experiments are siblings produced from hCD11b het¡Áhet crosses. The mice were randomly mixed in their genotype and gender, and then divided into groups.
Eight to nine weeks old WT or hCD11b homozygous C57BL/6 mice were infected with approximately 3¡Á106, 1¡Á107 or 1¡Á108 CFU of Staphylococcus aureus through the orbit. Initial experiments were performed with hCD11b homozygous mice derived from the G4 het¡Áhet cross. WT litters were used as controls. Subsequent experiments were performed with hCD11b homozygous mice derived from the G4 homo¡Áhomo cross. The Staphylococcus aureus strain used in this study was derived from the USA300 strain LAC and is detailed in Table S4. One or three days after infection, the mice were euthanized with CO2. The liver and kidney were taken out, homogenized in sterile PBS, serially diluted, and then coated on TSA for CFU count. Two to three independent experiments were performed for each strain.
The mouse anti-LukA (2¦Ìg/ml) monoclonal antibody was coated in the wells of the Immulon 2HB 96-well plate in carbonate-bicarbonate buffer at 4¡ãC overnight. The wells were blocked with blotting buffer (2% non-fat dry milk, 0.9% NaCl, 0.05% Tween 20, PBS), washed and infected with digestion in 1x radioimmunoprecipitation assay buffer (Abcam) + 1x Halt Protease Inhibitor The organs were incubated together at room temperature with a cocktail (Thermo Scientific) under shaking conditions for 1 hour. The wells are washed and incubated with anti-LukA rabbit serum (35) at a dilution of 1:500 for 1 hour at room temperature. Next, the wells were washed and incubated with anti-rabbit HRP at a dilution of 1:2500 for 1 hour at room temperature. Wash wells and incubate with 100 ¦Ìl TMB substrate for 5 minutes. The reaction was terminated with 100 ¦Ìl sulfuric acid, and the absorbance at 450 nm was measured. LukAB (micrograms/organ) is determined by comparison with a standard curve that is determined by measuring LukAB in organs to which a known amount of LukAB has been added.
C57BL/6 mice aged 8 to 9 weeks were injected retro-orbitally with PBS or about 1¡Á107 CFU of Staphylococcus aureus. One day after infection, the mice were euthanized. The liver and kidney were removed, homogenized in RPMI, and then digested in 200 U of type VIII collagenase (Sigma-Aldrich, C2139) and 0.2 mg of DNase I (Sigma-Aldrich, DN25). The homogenate was filtered, washed and loaded onto a 40/80% Percoll gradient. Centrifuge the gradient to remove the white blood cell layer. The RBC was lysed with 1¡ÁBD Pharm Lyse and washed. Use V500 CD11b (BD, 562128), PE-Cy7 CD45 (BioLegend, 147704), PE Ly6G (BD, 551461), APC F4/80 (BioLegend, 123116) and Fc in PBS at a concentration of 1:200 dilution. Place the stain on ice for 20 minutes, wash twice, and resuspend in FACS fixation buffer [PBS + 2% FBS + 2% PFA + 0.05% (w/v) sodium azide]. CytoFLEX flow cytometer (Beckman Coulter) was used to obtain flow cytometry data, and FlowJo software (TreeStar Inc.) was used to analyze the data.
The statistical details (“n” numbers, the test used and the definition of the error bars) are described in the legend. Use FlowJo to analyze the flow cytometer data. Statistical significance was determined using Prism 7.0 b, a two-way analysis of variance (ANOVA) with multiple comparisons using Tukey’s post hoc test, chi-square test or unpaired one-tailed or two-tailed Student t test (as shown).
For supplementary materials for this article, please see https://advances.sciencemag.org/cgi/content/full/6/11/eaax7515/DC1
This is an open access article distributed under the terms of the Creative Commons Attribution-Non-Commercial License, which allows the use, distribution and reproduction in any medium, as long as the final use is not for commercial gain and the premise is that the original work is correct. Reference.
Note: We only ask you to provide an email address so that the person you recommend to the page knows that you want them to see the email and that the email is not spam. We will not capture any email addresses.
This question is used to test whether you are a human visitor and to prevent automatic spam submissions.
Author: KM Boguslawski, AN McKeown, CJ Day, KA Lacey, K. Tam, N. Vozhilla, SY Kim, MP Jennings, SB Koralov, NC Elde, VJ Torres
Using a new mouse model to overcome the species specificity of the MRSA toxin LukAB can establish the role of LukAB in vivo.
Author: KM Boguslawski, AN McKeown, CJ Day, KA Lacey, K. Tam, N. Vozhilla, SY Kim, MP Jennings, SB Koralov, NC Elde, VJ Torres
Using a new mouse model to overcome the species specificity of the MRSA toxin LukAB can establish the role of LukAB in vivo.
©2021 American Association for the Advancement of Science. all rights reserved. AAAS is a partner of HINARI, AGORA, OARE, CHORUS, CLOCKSS, CrossRef and COUNTER. ScienceAdvances ISSN 2375-2548.
Post time: Mar-18-2021
